Fundamentals of Sequence Analysis, 1995-1996
Problem set 8:  Formatting data for publication.

If you get stuck, refer to the OpenVMS and GCG resources in the 
class home page.

  See the GCG and EGCG documentation.

Problem group 1.  Plasmid Maps

1A.  Produce a map of pBR322 (GB_SY:Synpbr322) showing all restriction
     sites that are present only once and all major features.

First find the single cutter restriction sites and make a tick file
that will be named synpbr322.tick

  $ mapsort/infile=gb_sy:synpbr322/plasmid/enzyme=*/once/default

Second, edit the documentary information into a file called
synpbr322.ranges, here are the contents of one such file: 

Cloning vector pBR322, features from comments
     Name     From       To   Strand  Color  FromSymbol  ToSymbol  Style ..

! big chunks, no direction implied

pSC101           1     1643      +     Blue       |          |     Block
Tn3           3148     4361      +     Blue       |          |     Block

! Protein coding regions

tet             86     1276      +     Black     |          >     Range
rop           1915     2106      +     Black     |          >     Range
bla           4153     3293      -     Black     |          >     Range

! little chunks, some have a direction, but are too small to put arrows on

! 3 promoters
P1              33       27      -     Green      |          |     Range
P2              43       49      +     Green      |          |     Range
P3            4194     4188      -     Green      |          |     Range
!  too small to see on this scale
!sig_peptide   4153     4085      -     Black     |          |     Range

! binding sites

echinomycin     24       27      +     Red        |          |     Tick
echinomycin     43       49      +     Red        |          |     Tick
echinomycin     53       56      +     Red        |          |     Tick
echinomycin     67       70      +     Red        |          |     Tick
echinomycin     80       83      +     Red        |          |     Tick
echinomycin    411      414      +     Red        |          |     Tick
echinomycin    469      472      +     Red        |          |     Tick
echinomycin   4268     4271      +     Red        |          |     Tick
echinomycin   4280     4283      +     Red        |          |     Tick
echinomycin   4285     4288      +     Red        |          |     Tick
echinomycin   4296     4299      +     Red        |          |     Tick
echinomycin   4311     4314      +     Red        |          |     Tick
echinomycin   4317     4320      +     Red        |          |     Tick
echinomycin   4331     4334      +     Red        |          |     Tick
dnaA          2439     2447      +     Red        |          |     Tick
rep_origin    2535     2535      +     Red        |          |     Tick

Third, list both files in synpbr322.fil:


Lastly, plot it:

$  plasmidmap/infile=@synpbr322.fil/noboldranges/noboldblocks/shaded=0

and here is the result:

Problem group 2.  Multiple sequence formatting

Align all Troponin C entries in SwissProtein.

Use LOOKUP with the word TROPONIN.  Then edit the resulting file to
leave only the Troponin C entries.  Run pileup: 

 $ pileup/infile=@lookup.list/out=tropc.msf

here is part of the MSF file showing aligned residues 51 to 100:

            51                                                 100

2A.  Format the .MSF file using Pretty showing the consensus and differences.

$ pretty/infile=tropc.msf{*}/outfile=tropc.pretty/consens -

Here is part of the result, showing aligned residues 51 to 100:

                       51                                                 100
Tropc.Msf{Tpca_Homam}  -vkisekn-q e--a-t---- --el-----v e-aakf-i-- deeal....k 
Tropc.Msf{Tpcb_Homam}  -vkisekn-q e--s-t---- --el-----v e-aakf-i-- deeal....k 
Tropc.Msf{Tpc2_Ponle}  -vkisekn-q q--a-t---- --el-----v e-aakf-i-- deeal....k 
Tropc.Msf{Tpc1_Homam}  -vkisdrh-q e--s-t---- --e------a a-aakf-s-- deeal....k 
Tropc.Msf{Tpc1_Ponle}  -vkiserh-q q--s-t---- --e------a e-aakf-s-- deeal....k 
Tropc.Msf{Tpc1_Balnu}  -ikvssts-k q--------- --q---s--- q-aakf-i-- deeam....m 
Tropc.Msf{Tpc2_Balnu}  --aynaqt-k el-----a-- --ml-----v t-aakfii-- daeam....a 
 Tropc.Msf{Tpc_Tactr}  --tfeek--k dl-a---q-- --el------ a-aa-f-v-- daeam....q 
Tropc.Msf{Tpcc_Human}  --n--p---q em-------- ---------- v--v-c---- skg-....s- 
Tropc.Msf{Tpcc_Rabit}  --n--p---q em-------- ---------- v--v-c---- skg-....s- 
Tropc.Msf{Tpcc_Mouse}  --n--p---q em-------- ---------- v--v-c---- skg-....s- 
Tropc.Msf{Tpcc_Chick}  --n--p---q em-------- ---------- v--v-c---- skg-....t- 
Tropc.Msf{Tpcc_Cotja}  --n--p---q em-------- -------q-- v--v-c---- skg-....t- 
Tropc.Msf{Tpcs_Chick}  --n--k---d a--------- ---------- v--v-q---- akg-....s- 
Tropc.Msf{Tpcs_Melga}  --n--k---d a--------- ---------- v--v-q---- akg-....s- 
Tropc.Msf{Tpcs_Mouse}  --t--k---d a--------- ---------- v--v-q---- akg-....s- 
Tropc.Msf{Tpcs_Rabit}  --t--k---d a--------- ---------- v--v-q---- akg-....s- 
Tropc.Msf{Tpcs_Human}  --t--k---d a--------- ---------- v--v-q---- akg-....s- 
  Tropc.Msf{Tpcs_Pig}  --t--k---d a--------- ---------- v--v-q---- akg-....s- 
Tropc.Msf{Tpcs_Ranes}  --t--k---d a--------- ---------- v--v-q---- aqg-....s- 
 Tropc.Msf{Tpc_Halro}  --n--ek--q em-----i-- ---------c l--y-q-qaq eea-ipere- 
 Tropc.Msf{Tpc_Brala}  -msisr---q qm-------a ---------- e--a-a-q-s ere....ip- 
 Tropc.Msf{Tpc_Patye}  -llvkd-kik dws--m---a t-rlnc-a-i q-fe-k---- lder...... 
            Consensus  GQ-PT-EEL- -IIEEVDEDG SGTIDFEEFL -MM-R-MKED ---K-----E 

2B.  Format the .MSF file using PrettyPlot.  Make the consensus Black, 
     identity Green, similarity Blue, and differences Red.  Also, turn
     off the boxes around similar sequence.

$! set up your GCG graphics first!!!
$ prettyplot/infile=tropc.msf{*}/consens -
  /CCOLOR/CIDE=green/CSIM=blue/COTher=Red/CCONS=black -

Here is part of the result, showing aligned residues 51 to 100:

2C.  Format the .MSF file using PrettyBOX.  Show a consensus, using
     output lines of 50 characters with no "block" spacing on the
     line.  Otherwise, use the default settings.

$! set up GCG graphics to put the result into a Postscript file
$ postscript laserwriter
$ prettybox/infile=tropc.msf{*}/consens/block=50/line=50/default

Here is part of the result, showing aligned bases 51 to 100:

Problem group 3.  Single sequence formatting

3A.  Format GB_IN:Dmhish1 for publication showing:

     1.  Protein translation under the DNA (3 letter form)
     2.  Forward sequence only (no reverse sequence)
     3.  Dots every 10 bases, above the DNA
     4.  Number at the ends of the dot line
     5.  Two blank lines between each group of lines
     50  bases per line

Begin by rearranging the requirements into a "top down" order
corresponding to what is desired in the final file.  Then translate
each requirement to the corresponding menu letter (being careful of

     3.  Dots every 10 bases                                     -> b
     4.  Number at the ends of the dot line                      -> b-> B
     2.  Forward sequence only (no reverse sequence)             -> c
     1.  Protein translation under the DNA (3 letter form)       -> f
     5.  Two blank lines between each group of lines             -> ii

The header of the file shows the protein from 106 to 876.  Here is the
log of the run, responses in bold, and this {return} means
just hit the "return" (or possibly, "enter") key. 

$ publish/infile=gb_in:dmhish1

Publish arranges sequences for publication.  It creates a text file
that you can modify to your own needs with a text editor. 

                  Begin (* 1 *) ?  {return}
                End (*   944 *) ?  {return}

  Please select the lines in the order in which
  you want them to appear in the figure.
      a) number line        :                10
      b) dot scale line     :                 .         .
      c) the sequence itself:        GAATTCACGATCGATCGTAG
      D) dash scale line    :     1  ---------+---------+  20
      e) the complement     :        CTTAAGTGCTAGCTAGCATC
      f) translation        :        GluPheThrIleAspArg
      g) translation        :        E  F  T  I  D  R
      h) tagged blank line  :   ###
      i) blank line         :
      j) 2nd sequence (diff):                C     G
      k) 2nd sequence (all) :        GAATTCACCATCGAGCGTAG
      l) match line         :        |||||||| ||||| |||||

  Select the lines in the order you wish them to appear
  and then press .  Use uppercase to identify the
  lines that you want numbered at the ends
                       (* cDefii *)  Bcfii
 What number is the first symbol in the row 1 ( * 1 *) ?  
 Please enter the ranges of translation for
 translation line number 1
 using the original coordinates of the sequence.
                  Begin (*    1 *) ?  106
                    End (*  944 *) ?  876
 Get another range from this sequence
 (* Yes *) ?  No
 How many symbols per block (* 60 *)? 50
 How many blocks do you want on each line (* 1 *) ? {return} 
 What should I call the output file (* Dmhish1.publish *) ?  {return}

Here is the formatted result:

      1           .         .         .         .         .   50
     51           .         .         .         .         .   100
    101           .         .         .         .         .   150
    151           .         .         .         .         .   200
    201           .         .         .         .         .   250
    251           .         .         .         .         .   300
    301           .         .         .         .         .   350
    351           .         .         .         .         .   400
    401           .         .         .         .         .   450
    451           .         .         .         .         .   500
    501           .         .         .         .         .   550
    551           .         .         .         .         .   600
    601           .         .         .         .         .   650
    651           .         .         .         .         .   700
    701           .         .         .         .         .   750
    751           .         .         .         .         .   800
    801           .         .         .         .         .   850
    851           .         .         .         .         .   900
    901           .         .         .         .      944